alesiabarrios6

since: 2018-05-03 20:17:41

Age: 40

About myself:

Profiles:

Asked questions: 5

Gave the right answers: 29

Points: 274

Best answer: 0

Questions

question

Mathematics, 19.04.2021 02:20

Infants MYLICON anti-gas drops contain 2 g of simethicone in a 30-mL container. (a) How many milligrams of the simethicone are contained in each 0.3-...

question

Health, 19.04.2021 02:20

For high school, the girls shot weights how much? A) 8.8 pounds B) 10 pounds C) 12 pounds D) 16 pounds...

question

History, 19.04.2021 02:20

Choose the three stages that best describe the progress of the French Revolution. monarchy, republic, empire terror, monarchy, republic republic, mona...

question

Mathematics, 19.04.2021 02:20

Given m||n, find the value of x. + 104

question

Social Studies, 19.04.2021 02:20

15. Read the following paragraph and comment on it. Medicine is too expensive for some chronic diseases for the ordinary people. So, ifpublic g...

question

Mathematics, 19.04.2021 02:20

Use the Quadratic Formula to solve the equation x2 + 4x = - 11....

question

Chemistry, 19.04.2021 02:20

How we can fit 40 gram of sugar which is (C12H24O12)in one can of coke?...

question

Mathematics, 19.04.2021 02:20

Which region represents the solution to the given system of inequalities? (x+3y 5-3 x23 5 4 А 3 2+ B...

question

Mathematics, 19.04.2021 02:20

A coat cost $37.88 at Walmart. The sales tax is 5.5%. What is the total amount of the coat including the sales tax?...

question

History, 19.04.2021 02:20

Which of the following is a private organization that attempts to influence public officials to act or vote in ways that will benefit the group’s memb...

question

Chemistry, 19.04.2021 02:20

Which of the following is an example of the clean technique? A. Ben sends all used scalpels to a department that washes them with an autoclave....

question

Chemistry, 19.04.2021 02:20

Anyone in for role playing?- qwq- bio down below, have nothing nice to say, don't say anything and just ignore this -n- Age: 15~Gender: Female~sexual...

question

Mathematics, 19.04.2021 02:20

At the beginning of spring, Dominic planted a small sunflower in his backyard. The sunflower's height in inches, hh, after ww weeks, is given by the e...

question

Mathematics, 19.04.2021 02:20

A pharmacist t is using the function P(t)=t2+t+1 Pt=t2+t+1 to calculate the number of prescriptions filled after t minutes. How man...

question

Biology, 19.04.2021 02:20

Genes that work together to produce a third trait...

question

English, 19.04.2021 02:20

What did Boo ask Scout after they had looked upon Jem, who was asleep? A "Do you hear the mockingbird?" B "Did you keep the pennies...

question

Chemistry, 19.04.2021 02:20

What volume will the gas in the balloon with 4.3 L of gas at 350K occupy at 250K?...

question

Biology, 19.04.2021 02:20

1) If a messenger RNA has the sequence: 5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3' a) What is the corresponding sequence of the coding strand (DNA...

question

Mathematics, 19.04.2021 02:20

Write a fraction equalto 1 with a denominatorof 7 (this question, 1 point)....

question

Mathematics, 19.04.2021 02:20

1. (Chapter 1) How does Mama react when Miss Crocker tell her about Cassie and Little Man’s behavior in class? How can you explain this reaction 2. (...