subject

Biology, 29.10.2019 06:31 torresalysabeth

Why is it important that human chromosomes have many origins of replication

ansver

Answers: 3

Show answers

Another question on Biology

question

Biology, 21.06.2019 13:50

Athermometer is placed in water in order to measure the water’s temperature. what would cause the liquid in the thermometer to rise?

Answers: 2

question

Biology, 21.06.2019 15:50

When species lose their habitats they may..

Answers: 2

question

Biology, 22.06.2019 09:00

What substance is the most acidic. lemon juice. tomato juice. sodium hydroxide. water

Answers: 1

question

Biology, 22.06.2019 10:50

The small molecule cyclic amp (camp) takes about 0.2 second to diffuse 10 μm, on average, in a cell. suppose that camp is produced near the plasma membrane on one end of the cell; how long will it take for this camp to diffuse through the cytosol and reach the opposite end of a very large cell, on average? assume that the cell is 200 μm in diameter.

Answers: 1

You know the right answer?

Why is it important that human chromosomes have many origins of replication...

Questions

question

SAT, 29.12.2021 04:10

Which equation justifies why nine to the one third power equals the cube root of nine?....

question

Chemistry, 29.12.2021 04:10

Question 10 of 10 Which two statements describe the seismic wave known as a P-wave? O A. It causes more damage than an S-wave.

question

SAT, 29.12.2021 04:10

Which energy career pathways work with renewable energy? check all that apply....

question

SAT, 29.12.2021 04:10

A rectangular prism has a volume of 170 cubic centimeters....

question

SAT, 29.12.2021 04:10

A right angle intersects a line at point m. A right angle intersects a vertical line at point m and forms 3 angles. From top to bottom going clockwise...

question

Chemistry, 29.12.2021 04:10

if, at equilibrium, the concentration of glucose 6-phosphate is greater than the concentration of glucose 1-phosphate, is the δg′° of the reaction pos...

question

English, 29.12.2021 04:10

Who wrote the poem how do i love thee let me count the ways...

question

Mathematics, 29.12.2021 04:10

What is the greatest common factor shared by 40 and 20? Answer here SUBMIT...

question

History, 29.12.2021 04:10

what groups formed during protests of the stamp act that continued on throughout the american revolution?...

question

SAT, 29.12.2021 04:10

It is impossible to circumscribe a circle about the quadrilateral below....

question

History, 29.12.2021 04:10

In what ways did WWII-era policies deliver prosperity to white veterans and their families while preventing the same for Americans and veterans of col...

question

English, 29.12.2021 04:10

I hesitated long before I put this theory to the test of practice. I knew well that I risked death; for any drug that so potently controlled and shook...

question

SAT, 29.12.2021 04:10

The population density of orangeland is 18 orange trees per acre. Exactly 792 orange trees grow in orangeland. How many acres are in orangeland?....

question

SAT, 29.12.2021 04:10

Kent multiplies both sides of the equation below by an expression. K + startfraction 12 over k endfraction = 8 then he moves all the terms to one side...

question

SAT, 29.12.2021 04:10

Compare the character of faustus at the beginning of the play with his character at the end. How have his character traits and basic ambitions shifted...

question

Biology, 29.12.2021 04:10

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA...

question

SAT, 29.12.2021 04:10

A stone fell from the top of a cliff into the ocean. In the air, it had an average speed of 161616 \text{m/s}m/sstart text, m, slash, s, end text. In...

question

Mathematics, 29.12.2021 04:10

What is 18 1/5 -7 3/5 as a mixed number in simplest form...

question

SAT, 29.12.2021 04:10

What are the typical sources of data which is used for data analytics....

question

Chemistry, 29.12.2021 04:10

Which of these describes a human activity that uses up a non-renewable resource? building new roads that cause topsoil to erode chopping...

More questions: Biology Another questions

Questions on the website: 13722361