subject
Biology, 06.12.2019 14:31 quoia89

After dante catches the flu virus, he feels very tired and loses his appetite. his body aches and he gets a high
which best describes dante's symptoms?
o
o
they are a response to an infection, which is an internal stimulus

they are a response to being tired, which is an external stimulus

they are a response to hunger, which is an internal stimulus

they are a response to an illness, which is an external stimulus
o

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 18:30
What role do traits play in affecting an organisms ability to reproduce? finches
Answers: 1
question
Biology, 22.06.2019 04:00
Number and variety of living organisms includes genetic, species, and ecological types
Answers: 3
question
Biology, 22.06.2019 06:00
In tomato plants, mendel found that the allele for smooth seeds (s) is dominant, while the allele for wrinkled seeds (s) is recessive. which of these punnett squares shows crosses between two plants heterozygous for smooth seeds? i need this to be answered as soon as ! sry the picture is bad quality
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
After dante catches the flu virus, he feels very tired and loses his appetite. his body aches and he...
Questions
question
Mathematics, 12.08.2020 09:01
question
History, 12.08.2020 09:01
Questions on the website: 13722360