Biology, 11.12.2019 18:31 grayjasmine46
Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the sequence taatacgactcactataggg has a melting temperature (tm) of 59 °c. if an rna duplex oligonucleotide of identical sequence (substituting u for t) is constructed, will its melting temperature be higher or lower?
Answers: 1
Biology, 20.06.2019 18:02
Dr. bad has developed a way to damage the atp-binding cassette transporter (abc transporter) on a cell. the cell's abc transporter can no longer bind and use atp when it's transporting substances. which of the following statements best describes how this damage would effect the transport of substances in the affected cell? (choice a) substances at a low concentration outside the cell would be more rapidly transported into the cell, where there is a high concentration. (choice b) substances at a high concentration outside the cell would not be transported into the cell, where there is a low concentration. (choice c) equilibrium would be established between all substances inside and outside of the cell. (choice d) substances at a low concentration outside the cell would not be transported into the cell, where there is a high concentration.
Answers: 3
Biology, 21.06.2019 13:00
Identify the advantages and disadvantages or renewable and nonrenewable energy resources
Answers: 3
Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the seque...
Mathematics, 26.07.2019 18:00
History, 26.07.2019 18:00
Biology, 26.07.2019 18:00
History, 26.07.2019 18:00
Computers and Technology, 26.07.2019 18:00
History, 26.07.2019 18:00
Social Studies, 26.07.2019 18:00
Business, 26.07.2019 18:00
Biology, 26.07.2019 18:00
History, 26.07.2019 18:00
History, 26.07.2019 18:00