PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation i...
Biology, 10.02.2020 02:05 ykpwincess
PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Be sure to answer this question in paragraph form using complete sentences.
Answers: 1
Biology, 21.06.2019 18:40
The oxidizing agent our bodies use to obtain energy from food is oxygen (from the air). if you breathe 15 times a minute (at rest), taking in and exhaling 0.5 l of air with each breath, what volume of air do you breathe each day? air is 21% oxygen by volume. what volume of oxygen do you breathe each day?
Answers: 1
Biology, 22.06.2019 03:30
Awire-hair terrier and a smooth-hair terrier are mated. the offspring produced are 6 wire-hair puppies and 2 smooth-hair puppies. a. what pattern of inheritance best describes this situation? b. what is the genotype(s) of the wire-haired puppies? of the smooth-haired puppies? c. what would be the expected genotype and phenotype ratios of a mating between 2 wire-haired terriers that are heterozygous?
Answers: 3
Biology, 22.06.2019 12:10
Adescription of a type of bio biotechnology (genetic engineering, cloning, or artificial section) one benefit or one risk for the individual (based on whether you are for or against it) one benefit or one risk for society (based on whether you are for or against it) one benefit or one risk for the environment (based on whether you are for or against it)
Answers: 2
English, 31.10.2020 14:00
Social Studies, 31.10.2020 14:00
Mathematics, 31.10.2020 14:00
Biology, 31.10.2020 14:00
Mathematics, 31.10.2020 14:00
Physics, 31.10.2020 14:00
Biology, 31.10.2020 14:00
History, 31.10.2020 14:00
Mathematics, 31.10.2020 14:00
Mathematics, 31.10.2020 14:00
Mathematics, 31.10.2020 14:00