A scientist randomly mutates the DNA of a bacterium. She then sequences the bacterium’s daughter cells, and finds that the daughters have many errors in their replicated DNA. The parent bacterium likely acquired a mutation in which enzyme?
a) DNA ligase
b) Primase
c) DNA pol II
d) DNA pol I
Answers: 2
Biology, 22.06.2019 04:30
Why is it incorrect to say that mitochondria function only as energy factories with cell
Answers: 1
Biology, 22.06.2019 11:30
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:20
What contributes to the high level of biodiversity found in wetlands? a. the large amount of available organic matter to organisms that are food for larger organisms b. the amount of available water for organism use c. the high nutrient availability d. all of the above select the best answer from the choices provided a b c d
Answers: 2
A scientist randomly mutates the DNA of a bacterium. She then sequences the bacterium’s daughter cel...
Mathematics, 05.11.2019 04:31
Mathematics, 05.11.2019 04:31
Chemistry, 05.11.2019 04:31