A Picture Says It! 18. Explain what this image represents regarding where your entire DNA
code can be found.

~fourth largest plate ~includes parts of the indian and atlantic oceans ~subducts below the eurasian plate on the west side ~ the arabian and somali plates form boundaries with it what is the name of the tectonic plate described above? a) african plate b) eurasian plate c) north american plate d) indo- australian plate

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Which of the following is the function of the nociceptors? a. detecting odors in the nose b. detecting painful stimuli c. detecting central body temperature d. detecting touch and pressure