What is the purpose of replication? To wrap DNA up into a chromosome
To make RNA
To make a copy of all the DNA in the nucleus before mitosis occurs
To make a copy of only certain genes

Put the following processes of protein synthesis in the correct order: - dna strands unwind and separate - mrna copies dna according to complimentary base pairing - trna's anticodons bring amino acids to the corresponding mrna codons - amino acids bind to each other making a protein - mrna leaves the nucleus - a stop codon is reached, the newly formed protein is released to go do its job for the cell

What occurs to the cell during mitosis

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?