Compare the two DNA strands below to identify the type of mutation that has taken place. DNA strand #1: AACGTTGCGGCCATCGTGCTAATG
DNA strand #2: AACGTTCGGCCATCGTGCTAATGA

Elephants in the savanna regions of africa dig holes in dried up river beds to reach water lying just below the surface. these holes provide drinking water for other animals as well. so, without the elephants, many animals might otherwise die from lack of water during the dry season. the location in which the elephants live is an example of a/n and the role they play in creating water holes is an example of a a) ecosystem; habitat b) community; niche c) habitat; niche d) niche; habitat

What do isotopes of uranium have the same number of? what do they have a different number of? a) same number of protons; different number of electrons b) same number of protons; different number of neutrons c) same number of electrons; different number of protons d) same number of neutrons; different number of protons

Cells must be in osmotic equilibrium with their surroundings environments because if they swell or shrink thier membranes will rupture