Biology, 05.03.2021 05:40 Jwelch4171
Air-breathing vertebrates have a specialized system for the movement of air. Parts of
the body involved with breathing include
the brain
diaphragm muscle
gas levels in the blood
rib muscles
all of the above
Answers: 2
Biology, 21.06.2019 22:00
Protein synthesis actually begins in the nucleus when transcribes a single gene on the dna molecule is copied. the process of copying this gene is called this copy is known as and contains the protein building instructions. this copy is sent out into the cytoplasm to the part of the cell known as the the of the ribosome will join together to form a functional ribosome when they attach to the mrna. as the mrna moves through the ribosome, the message is read by transfer rna brings the correct back to the ribosome. the amino acids are placed in the correct order and are hitched together by
Answers: 3
Biology, 22.06.2019 08:30
Answer now! good pts and a brainliest potatoes are what im like a potatoe irdk have a good day
Answers: 2
Biology, 22.06.2019 11:30
There are multiple lines of evidence that provide support for common ancestry and evolution. write 3-4 paragraphs describing at least three of them in detail. provide at least one example for each line of evidence.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Air-breathing vertebrates have a specialized system for the movement of air. Parts of
the body invo...
History, 17.03.2021 23:40
Mathematics, 17.03.2021 23:40
Mathematics, 17.03.2021 23:40
Arts, 17.03.2021 23:40
Mathematics, 17.03.2021 23:40
Mathematics, 17.03.2021 23:40
English, 17.03.2021 23:40
English, 17.03.2021 23:40
Mathematics, 17.03.2021 23:40
Mathematics, 17.03.2021 23:40
Mathematics, 17.03.2021 23:40
French, 17.03.2021 23:40
Mathematics, 17.03.2021 23:40
Health, 17.03.2021 23:40