Hoof type in pigs is determined by a gene with the dominant allele (H) resulting in a fused hoof while the recessive allele (h) gives rise to a cloven hoof. The color pattern of the animal’s coat is determined by a dominant allele (B) that results in a belted pattern or a recessive allele (b) that leads to a solid color. Give the possible genotypes and phenotypes of the progeny resulting from crossing a HhBB male with a HhBb female. In pole beans, the color of the bean is controlled by a gene with the dominant Red (R) allele and pale-green (r) allele is recessive. The mode of growth, either climbing or bush is controlled by another gene on another set of homologous chromosomes. The climbing (B) mode of growth is dominant over bush (b). A red bush plant was crossed with a pale-green climbing plant. Of the offspring there were approximately equal numbers of red, climbing; red, bush; pale-green, climbing; and pale-green bush. Give the genotypes of the parents and offspring.

What is a traditional chinese touch therapy involving finger pressure applied to specific areas of the body to restore the flow of qi.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

What nerve is affected in bell palsy