subject
Biology, 26.03.2021 23:30 yejinschoi3007

Question 3 As compared to developing countries, developed countries have a
A higher average income, a higher rate of population growth, and produce more waste.
B.
lower average income, a higher rate of population growth, and produce less waste.
С
higher average income, a lower rate of population growth, and produce more waste.
D
lower average income, a lower rate of population growth, and produce less waste.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 11:30
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:00
The sea slug that considered to be a photosyntheesizing animal
Answers: 2
question
Biology, 22.06.2019 15:20
What two factors does carrying capacity compare? population size and resource use population growth and resource availability resource use and time population size and time
Answers: 2
You know the right answer?
Question 3 As compared to developing countries, developed countries have a
A higher average i...
Questions
question
English, 19.09.2020 01:01
question
Mathematics, 19.09.2020 01:01
question
English, 19.09.2020 01:01
Questions on the website: 13722360