subject
Biology, 11.05.2021 20:50 hhomeschool24

What is secondary succession

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 17:30
Charles darwin published his theory of evolution in 1859. in what way foes modern evolutionary theory differ from the theory as proposed by darwin? a) darwin inferred that individuals can evolve, but modern generic science has shown that this is not true. b)darwin inferred that individuals do not evolve, but modern genetic science has shown that this is not true. c)modern science has disproved most of darwin's original theory of evolution, because darwin knew nothing about generations and their role in heredity. d)generic studies have shown that gene expression and other factors operate along with natural selection, but most of darwin's theory has been supported by modern science.
Answers: 1
question
Biology, 22.06.2019 02:00
2. given that most biochemical (other than coal) rocks react with hydrochloric acid, what does that tell you about organisms?
Answers: 1
question
Biology, 22.06.2019 11:00
Every early childhood education program should develop a
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What is secondary succession...
Questions
Questions on the website: 13722367