subject
Biology, 21.10.2019 14:00 guko

Which sequence correctly describes the flow of genetic information in a cell?
a. proteins → rna → dna
b. dna → rna → proteins
c. rna → proteins → dna
d. the flow of genetic information varies.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 04:30
Types of scientific inquiry that biologist engage in that cannot be completely controlled
Answers: 1
question
Biology, 22.06.2019 09:50
Producing disposable grocery bags consumes resources. recycling disposable bags is a solution that can recover some of the resources used to make new bags. which of the following behaviors could further refine the solution? a. disposing of bags by burning them b. reusing bags whenever possible c. using bags at once so that they do not break d. using only nonrenewable materials to make new bags subject is environmental science for apex users
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:30
The table above shows five different types of chromosomal abnormalities that can occur during meiosis. they result in either an individual having too many or too few chromosomes in their genome. what is the most likely cause of these chromosomal abnormalities?
Answers: 1
You know the right answer?
Which sequence correctly describes the flow of genetic information in a cell?
a. proteins →...
Questions
question
Computers and Technology, 01.10.2021 18:00
question
Mathematics, 01.10.2021 18:00
question
Mathematics, 01.10.2021 18:00
question
Mathematics, 01.10.2021 18:00
Questions on the website: 13722367