Biology, 27.07.2019 07:00 olejlund8073
An antigen is whereas an antibody is a foreign substance such as a protein or a polysaccharide to which lymphocytes respond; a globular protein that reacts with an antigen to eliminate the antigen an immunoglobulin that is produced by lymph nodes in response to bacteria; a foreign protein that enters the body and causes an immune reaction a hapten molecule that is complex in shape; an enzyme produced by the thymus gland that neutralizes antigens only on a pathogen; only in a human body. none of the above
Answers: 1
Biology, 21.06.2019 15:30
Which plant has a visible leaf modification that will it conserve water in extremely dry environments?
Answers: 1
Biology, 22.06.2019 00:00
Hurry which of these is true about index fossils? a) are very scarcely found b) used as guides in relative dating c) found in the youngest layer of the rock d) used as reference points in absolute dating
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:10
People with one sickle cell allele are not likely to get malaria. what is this an example of?
Answers: 1
An antigen is whereas an antibody is a foreign substance such as a protein or a polysaccharide to...
Physics, 21.04.2021 16:10
Mathematics, 21.04.2021 16:10
Mathematics, 21.04.2021 16:10
Mathematics, 21.04.2021 16:10
Social Studies, 21.04.2021 16:10
Arts, 21.04.2021 16:10
Mathematics, 21.04.2021 16:10
Mathematics, 21.04.2021 16:10
Chemistry, 21.04.2021 16:10
Mathematics, 21.04.2021 16:10
Biology, 21.04.2021 16:10
Mathematics, 21.04.2021 16:10
History, 21.04.2021 16:10
Mathematics, 21.04.2021 16:10