subject

History, 10.07.2019 07:30 nook4boo

Which organization was founded in 1909 by w. e.b dubois to fight racial injustice? a. afl-cio b. naacp c. aclu d. iww need fast

ansver

Answers: 1

Show answers

Another question on History

question

History, 22.06.2019 01:30

This document provides the framework for the united states government. it consists of three main parts: the preamble, seven articles, and 27 amendments.

Answers: 1

question

History, 22.06.2019 06:00

Causes and effect chart for industrial revolution

Answers: 1

question

History, 22.06.2019 08:00

In the space provided, analyze the pros and cons of establishing smaller ethnic communities within larger communities like chinatown and little italy. use evidence to support your reasoning.

Answers: 1

question

History, 22.06.2019 09:40

4. choose one of the protagonists and explain how he advances the plot of his particularnarrative. how does the combination of his internal and external conflicts move the storyalong? who is the antagonist in the narrative?

Answers: 1

You know the right answer?

Which organization was founded in 1909 by w. e.b dubois to fight racial injustice? a. afl-cio b. na...

Questions

question

History, 01.04.2021 17:30

At the "first Thanksgiving," the Pilgrims famously feasted with the American Indians. Think about what you learned about Pilgrims, Puritans, and Ameri...

question

English, 01.04.2021 17:30

Which sentence best explains Lincoln's wartime decisions? BRANLIEST adapted from Lincoln the Great by Wilfred W. McClay We should r...

question

English, 01.04.2021 17:30

What Is the parallel structure and how do I find it?...

question

Business, 01.04.2021 17:30

The manufacturing overhead budget at Foshay Corporation is based on budgeted direct labor-hours. The direct labor budget indicates that 7,800 direct l...

question

English, 01.04.2021 17:30

For a company to develop an effective customer-centric culture, there is always room for:...

question

Mathematics, 01.04.2021 17:30

This math problem help me...

question

Biology, 01.04.2021 17:30

What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?...

question

Chemistry, 01.04.2021 17:30

Which of the following statements are true regarding the remainder of the experiment if the scientist wants to use the combined gas law to calculate d...

question

Biology, 01.04.2021 17:30

Which scenario MOST LIKELY represents genetic drift and why? Question 2 options: Scenario 2, because the dark beetles are most fit for th...

question

Mathematics, 01.04.2021 17:30

Please help Lia brought 21 shirts and plants. Her total was $357. Pants cost $25 each, and shirts cost $14.50 each. How many of each item did she buy?...

question

Business, 01.04.2021 17:30

The McAllisters had several serious problems with their house, including leaks in the ceiling, a buckling wall, and dampness. They repaired the buckli...

question

Business, 01.04.2021 17:30

The goal of the review in a business presentation is to Multiple choice question. compel audience members to consider taking specific actions. lead au...

question

History, 01.04.2021 17:30

"If a thousand [citizens] were not to pay their tax-bills this year, that would not be a violent and bloody measure, as it would be to pay them, and e...

question

History, 01.04.2021 17:30

Which TWO of the following is a task carried out by the executive branch? Select two answers....

question

Mathematics, 01.04.2021 17:30

Solve for x please help ...

question

History, 01.04.2021 17:30

Do you think something like the Red Scare could happen again?...

question

Mathematics, 01.04.2021 17:30

Which is equivalent to (–9n + 12)?...

question

English, 01.04.2021 17:30

Okay who wants to prank call my school? well the # is (616) 538-7670 call and say hey can i order a medium deep dish pizza with extra cheese an...

question

Mathematics, 01.04.2021 17:30

Which angles are adjacent to each other? Select all that apply.

question

Mathematics, 01.04.2021 17:30

Find a mobius transformation T that takes the real axis to the unit circle and then evaluate the resulting integral....

More questions: History Another questions

Questions on the website: 13722360