History, 19.11.2019 12:31 alicat20

Which principles of democracy are not followed in an authoritarian state.

Answers: 1

Show answers

Another question on History

History, 21.06.2019 23:00

Which geographic process is shown in this chart? (3 points) redlining gentrification filtering ghettoization suburbanization

Answers: 1

Answer

History, 21.06.2019 23:00

Which statement best explains how the invention of corporations contributed to the economy in the 1800's

Answers: 3

Answer

History, 22.06.2019 05:00

This map is depicting the 16th century route of what explorer? a) hernando de soto b) james oglethorpe c) sir walter raleigh d) juan ponce de leon

Answers: 2

Answer

History, 22.06.2019 05:30

What are the causes and effects of the spread of christianity

Answers: 1

Answer

You know the right answer?

Which principles of democracy are not followed in an authoritarian state....

Questions

English, 07.01.2021 06:00

How can we say that junk food has become a global culture....

History, 07.01.2021 06:00

16. Which of the Olympian gods did not spend much time on Mount Olympus?...

English, 07.01.2021 06:00

. (You are your own CNI X What have I learned about the X Grc s/d/e/1FAIpQLSCOJOR23nXTNZ0a7otPHZh mv8eDZRGmosB151v5HqPg The loss o...

Biology, 07.01.2021 06:00

AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three d...

Mathematics, 07.01.2021 06:00

Lin’s teacher uses a box to store her set of cubes with an edge length of 1/2 inch if the box is completely full how many cubes are in the set?...

Social Studies, 07.01.2021 06:00

I need help for this ...

Mathematics, 07.01.2021 06:00

Hailey has a 5foot long extension...

Social Studies, 07.01.2021 06:00

Someone help me please ...

Social Studies, 07.01.2021 06:00

WORTH 75 POINTS IN 15HRS MARKING BRAINLIST QUESTION 1This program consists of three lottery-funded scholarships for Florida high school g...

Mathematics, 07.01.2021 06:00

It takes 18 hours to fill a pool using 8 garden hoses. How long would it take to fill the same pool using 9 garden hoses? (Answer is definitely NOT 20...

English, 07.01.2021 06:00

What objects could represent time in chapter 5 of the great gatsby? What happens to these objects? What is the author communicating about time?...

Mathematics, 07.01.2021 06:00

Friends who want report? im a girl bf?...

Physics, 07.01.2021 06:00

CAN SOMEONE PLEASE HELP ME I DON'T UNDERSTAND ...

Mathematics, 07.01.2021 06:00

Answers for both boxes please ...

English, 07.01.2021 06:00

In the chart, identify the text structure(s) used in the reading selection "Collecting Rocks." Complete the chart by including signal words you read....

Arts, 07.01.2021 06:00

Why did Chuck Close influence 4 others to paint art which became apart of our U. S. history?...

Mathematics, 07.01.2021 06:00

PLEASE HELP MEEE A rocket carrying fireworks is launched from a hill 80 feet above a lake. The rocket will fall into the lake after exploding a...

Mathematics, 07.01.2021 06:00

7/8 divided by 1/8 pluse 2by the power of 2...

Mathematics, 07.01.2021 06:00

Rajan had 30 dollars to spend on 3 gifts. He spent 9 1 4 dollars on gift A and 5 4 5 dollars on gift B. How much money did he have left for gift C?...

Mathematics, 07.01.2021 06:00

if Olivia works 4 hours more each week than her coworker lily, if Olivia works 32 hours in 2 weeks how many hours does lily works...

More questions: History Another questions