History, 16.10.2019 20:10 3boys33

What were columbus' view on christianity?

a. he felt he had religion had no place in exploration.
b. he saw himself as divinely chosen to carry religion through his voyages.
c. he agreed to adopt christianity if it meant funding for his voyages.
d. he was interested in understanding how christianity related to the religions of native peoples he encountered.

Answers: 2

Show answers

Another question on History

History, 21.06.2019 14:00

As a result of the columbian exchange, which crop was transferred to europe from the americas and later spread through the world? a coffee b maize (corn) c rice d olives e wheat

Answers: 3

Answer

History, 21.06.2019 22:30

How did the constitution of 1917 try to resolve some of the problems that started the mexican revolution

Answers: 1

Answer

History, 22.06.2019 01:30

During the era of european expansion, what was the biggest reason for spain’s push for exploration?

Answers: 1

Answer

History, 22.06.2019 06:30

What was president theodore roosevelt’s square deal

Answers: 1

Answer

You know the right answer?

What were columbus' view on christianity?

a. he felt he had religion had no place in e...

Questions

Mathematics, 21.09.2021 21:50

4x^2(x-2)-9(x-2)=(x-2)( ? )...

History, 21.09.2021 21:50

Examine the dates in this timeline: 1757 1813 1848 1857 1877 1757: British troops overthrow the native governmen...

Business, 21.09.2021 21:50

Cox Company has the following stockholders' equity section of its balance sheet on January 1: Additional Resources Cox Company Stockholders' Equity Ja...

Mathematics, 21.09.2021 21:50

What is the terms in this expression, 5 - 4x - 8...

Arts, 21.09.2021 21:50

RIGHT ANSWER GETS BRAINLIEST What is Form? 1.A mark that has a length and direction 2.Shape with height, width, and depth 3....

Mathematics, 21.09.2021 21:50

RatiosAt the ice cream shop, there are 14 shakes sold for every 6 malts. Record the ratio below:Malts to Shakes...

Chemistry, 21.09.2021 21:50

PLZ HELP M Explain why the skater must be at a specific height at the start to make it successfully to the end of the ramp. Be sure to use the terms...

Mathematics, 21.09.2021 21:50

a laptop cost $600 in 2017, was worth #300 in 2019, $175 in 2020, and only $100 in 2021. each figure is for the first day of each year (jan). what is...

Mathematics, 21.09.2021 21:50

What will drink 3 taste like in comparison to drink 2? a Drink 3 will taste more sweet. b Drink 3 will taste the same as drink Dri...

Mathematics, 21.09.2021 21:50

What is the effect on the graph of the function f(x) = IXI when f(x) is changed to f(x + 9)? A) shifts right by 9 units B) shifts...

Biology, 21.09.2021 21:50

What would be the primary structure of this small protein made from the following DNA sequence? TACTCTGATAATGCCGTCATT

English, 21.09.2021 21:50

Please someone help me ...

Mathematics, 21.09.2021 21:50

Draw the dilation image A'B'C'D' of the trapezoid ABCD with the center of the dilation at the origin and the scale factor -2. Include the original tra...

English, 21.09.2021 21:50

Udy Blume's career as an American writer spans four decades and includes many literary awards. She is most famous for her novels geared toward pre-tee...

Mathematics, 21.09.2021 21:50

Can someone please help me with this question, thank you! :)

Spanish, 21.09.2021 21:50

How would you like to travel internationally to a place where Spanish is spoken? This is your chance to plan the perfect vacation! If there is a loc...

Mathematics, 21.09.2021 21:50

Plz help me 20 points no links ...

Mathematics, 21.09.2021 21:50

Which graph represents a proportional relationship?

English, 21.09.2021 21:50

Story is button button by Richard Matheson ...

Chemistry, 21.09.2021 21:50

what volume of hydrogen at STP is produced by the reaction of 50.0g of Mg and the equivalent of 75g of HCL...

More questions: History Another questions