History, 24.06.2020 02:01 gransazer863

Which argument would most likely be attributed to a Progressive reformer? A. "Decrease the influence of immigrants."
B. "Shrink the power of special interest groups.
C. "Shorten the campaign season."
D. "Make politicians more accountable to the public."

Answers: 2

Show answers

Another question on History

History, 21.06.2019 14:30

Draw conclusions why might a cause like italian unification successfully draw people of very different backgrounds together?

Answers: 2

Answer

History, 21.06.2019 20:30

Briefly explain one result of either louis napoleon's or otto von bismarck's policies that is not mentioned directly in the speech.

Answers: 2

Answer

History, 21.06.2019 22:00

Articles of confederation dbq assignment. was the poster ”announcing an all new plan of government! ” written by a federalist or a non federalist?

Answers: 1

Answer

History, 21.06.2019 23:30

What role and side did italy fight on during world war 1? why did they change sides? write this in your own words.

Answers: 1

Answer

You know the right answer?

Which argument would most likely be attributed to a Progressive reformer? A. "Decrease the influenc...

Questions

Chemistry, 26.01.2021 17:50

How does a covalent bond differ from an ionic bond...

Mathematics, 26.01.2021 17:50

Simplify the expression 4(n-3) + 2(-3+n)...

English, 26.01.2021 17:50

Can someone help me with this ...

Biology, 26.01.2021 17:50

Compare the two DNA strands below to identify the type of mutation that has taken place. DNA strand #1: AACGTTGCGGCCATCGTGCTAATG DNA strand #2:...

Health, 26.01.2021 17:50

F. “Taking drugs is not to enjoy but to kill ourselves and destroy the family structure." Justify....

English, 26.01.2021 17:50

2 What is Richard Bone's occupation? OA) He manages a cemetery. B) He is a sculptor of statues. c) He is a historian. D) He carves...

Mathematics, 26.01.2021 17:50

A T. V. has an aspect rato of 4:3 and a size of 60 inches. What is the length and width of the T. V.?...

English, 26.01.2021 17:50

HELPP GCSE English language paper 1 ‘The silent land’ 4. Focus this part of your answer on the second part of the source, from line 28 to the e...

History, 26.01.2021 17:50

What agreement did Britain and the United States make in the Treaty of 1818? joint control of the Oregon Country for ten years joint control of...

Social Studies, 26.01.2021 17:50

Drag the tiles to the correct boxes to complete the pairs. Match these lodging categories to the type of business operations reflected by them.

Social Studies, 26.01.2021 17:50

Jaylene wants to convince her parents to let her visit the mall during the busiest shopping weekend of the year. She claims that the mall is a safe en...

Mathematics, 26.01.2021 17:50

Apply the appropriate mathematical operation to solve this ratio problem. The recommended protein in grams is numerically equal to the person's weigh...

History, 26.01.2021 17:50

IM DONE.Goodbye everyone FOREVER I can't do this anymore. I'm being fr. Goodbye...

Mathematics, 26.01.2021 17:50

Which Algebraic rule describes the transformation? A. (x, y) - (-x, y) B. (x, y) - (x,-y) C. (x, y) - (-x,-y) D. (x, y) - (-y,-x)

Mathematics, 26.01.2021 17:50

Which value is equivalent to 8?...

Health, 26.01.2021 17:50

Describe a situation in which someone expressed his or her emotions in a positive and effective way. What was the emotion, how was it expressed? Why...

History, 26.01.2021 17:50

The idea in this excerpt above is most directly associated with which of the following? "The religious history of the early republic's Second Great A...

Advanced Placement (AP), 26.01.2021 17:50

Barney wants to rent a tent. He has to pay a fixed base cost plus a daily rate for renting the tent. The table shows the amount of money, y, in dollar...

Mathematics, 26.01.2021 17:50

WILL GIVE BRAINLIEST A bacteria grows exponentially so that it doubles every 12 days. There are 500 bacteria initially. Write a function that models...

History, 26.01.2021 17:50

What most shows Aristotles Athenian background...

More questions: History Another questions

Which argument would most likely be attributed to a Progressive reformer? A. "Decrease the influence of immigrants." B. "Shrink the power of special interest groups. C. "Shorten the campaign season." D. "Make politicians more accountable to the public."

Answers

Another question on History

Which argument would most likely be attributed to a Progressive reformer? A. "Decrease the influence of immigrants."
B. "Shrink the power of special interest groups.
C. "Shorten the campaign season."
D. "Make politicians more accountable to the public."