Mathematics, 16.03.2020 06:40 maustin5323

Hiw do I Graph the line y=-3

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 15:30

Find the slope of the line below . enter your answer as a fraction or decimal. use a slash mark ( / ) as the fraction bar if necessary

Answers: 3

Answer

Mathematics, 21.06.2019 19:40

Which is the solution to the inequality? 2 3/52 1/15 b< 3 2/15 b> 3 2/15

Answers: 1

Answer

Mathematics, 21.06.2019 23:00

Divide. –4.2 ÷ 6 = a –0.7 b 0.7 c –7 d 7 me

Answers: 2

Answer

Mathematics, 22.06.2019 01:00

Given right triangle a w/a hypotenuse length of x+4 and a leg of x, and right triangle b, w/ a hypotense length of 3y and a leg length of y+4 for what values of x and y are the triangles congruent by hl?

Answers: 3

Answer

You know the right answer?

Hiw do I Graph the line y=-3...

Questions

Health, 28.10.2019 21:31

Indicate whether each statement is true or false regarding type 1 and type 2 diabetes mellitus. 1. type 1 diabetes mellitus is also called non-...

Business, 28.10.2019 21:31

Molly mocha employs one college student every summer in her coffee shop. the student works the five weekdays and is paid on the following monday. (for...

Chemistry, 28.10.2019 21:31

Which has the higher enthalpy under these conditions, 2 o3(g) or 3 o2(g)?...

Business, 28.10.2019 21:31

Jill lives in a large metropolitan area. she is thinking about starting a senior citizen van service, where she will pick up seniors from nursing home...

Mathematics, 28.10.2019 21:31

Give an example of a quadratic equation with 2 + 3i as one of its solutions...

Mathematics, 28.10.2019 21:31

Define: voluntary responsea) every possible sample of a given size has the same chance to be selected. b) using extraneous factors to create similar...

Chemistry, 28.10.2019 21:31

Which of these equations represent reactions that could be used in constructing an electrochemical cell? check all that apply....

Chemistry, 28.10.2019 21:31

By looking at the uncertainty of the bacterium's position, did the student have a valid point? a. the student has a point. the uncertainty of...

Biology, 28.10.2019 21:31

Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this mrna? provide the sequence in form (sing...

Biology, 28.10.2019 21:31

What is the main advantage of a sole proprietorship?...

Physics, 28.10.2019 21:31

Development of life goals, access to community resources, long-term counseling, and accountability are all examples of case management....

Mathematics, 28.10.2019 21:31

Ababy woolly mammoth that was discovered in 2007 died approximately 39,000 years ago. how many c-14 atoms per 1.0 × 108 c-12 atoms would have be...

Mathematics, 28.10.2019 21:31

Use the method in the example to find the square roots of 1 + √3i...

Business, 28.10.2019 21:31

The term ""insecure laboratory procedures"" in the definition of a biohazard presented in this educational module refers to which element of biohazard...

Business, 28.10.2019 21:31

The town of genter recently witnessed a devastating hurricane that crippled the town's infrastructure. q-mart, a retail chain that plans to open a new...

Mathematics, 28.10.2019 21:31

Which is an example of gaining a static charge by conduction?...

Social Studies, 28.10.2019 21:31

Which general conclusion did issac newton observation of gravity have on the way we understand the universe...

Mathematics, 28.10.2019 21:31

Which of the inequalities matches the statement? "a number y, increased by 14 is greater than 22" a)y-14> 22 b)y-14<...

Social Studies, 28.10.2019 21:31

What signals the adrenal glands to produce more of the hormones adrenaline and cortisol and release them into the bloodstream?...

Biology, 28.10.2019 21:31

What properties of water allow water to move up the stem of a plant and overcome gravity?...

More questions: Mathematics Another questions