subject

Mathematics, 21.04.2020 16:22 glowbaby123

In Vincent's classroom there are red chairs, yellow chairs, and blue chairs. There are 6 red
chairs. There are 3 times as many yellow chairs as red chairs, and there are 2 fewer blue
chairs than yellow chairs. How many chairs are there in Vincent's classroom?

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 18:00

Jacob signs up to work for 2 1/2 hours at the school carnival. if each work shift is 3/4 hour, how many shifts will jacob work? (i just want to double check : |, for anybody that responds! : )

Answers: 3

question

Mathematics, 21.06.2019 21:30

Can someone explain to me how to do

Answers: 1

question

Mathematics, 21.06.2019 22:30

Maria found the least common multiple of 6 and 15. her work is shown below. multiples of 6: 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, . . multiples of 15: 15, 30, 45, 60, . . the least common multiple is 60. what is maria's error?

Answers: 1

question

Mathematics, 22.06.2019 00:00

Solve 17= -13 - 8x and show your work.

Answers: 1

You know the right answer?

In Vincent's classroom there are red chairs, yellow chairs, and blue chairs. There are 6 red
c...

Questions

question

Physics, 29.12.2021 04:10

The refractive index for a transparent medium with a critical angle, c, for light travelling from the medium to air is?...

question

Physics, 29.12.2021 04:10

A 0.5 kg ball is rolling down a hill going at 4 m/s. How much force is acting on the ball if it rolled for 5 m?...

question

SAT, 29.12.2021 04:10

Which equation justifies why nine to the one third power equals the cube root of nine?....

question

Chemistry, 29.12.2021 04:10

Question 10 of 10 Which two statements describe the seismic wave known as a P-wave? O A. It causes more damage than an S-wave.

question

SAT, 29.12.2021 04:10

Which energy career pathways work with renewable energy? check all that apply....

question

SAT, 29.12.2021 04:10

A rectangular prism has a volume of 170 cubic centimeters....

question

SAT, 29.12.2021 04:10

A right angle intersects a line at point m. A right angle intersects a vertical line at point m and forms 3 angles. From top to bottom going clockwise...

question

Chemistry, 29.12.2021 04:10

if, at equilibrium, the concentration of glucose 6-phosphate is greater than the concentration of glucose 1-phosphate, is the δg′° of the reaction pos...

question

English, 29.12.2021 04:10

Who wrote the poem how do i love thee let me count the ways...

question

Mathematics, 29.12.2021 04:10

What is the greatest common factor shared by 40 and 20? Answer here SUBMIT...

question

History, 29.12.2021 04:10

what groups formed during protests of the stamp act that continued on throughout the american revolution?...

question

SAT, 29.12.2021 04:10

It is impossible to circumscribe a circle about the quadrilateral below....

question

History, 29.12.2021 04:10

In what ways did WWII-era policies deliver prosperity to white veterans and their families while preventing the same for Americans and veterans of col...

question

English, 29.12.2021 04:10

I hesitated long before I put this theory to the test of practice. I knew well that I risked death; for any drug that so potently controlled and shook...

question

SAT, 29.12.2021 04:10

The population density of orangeland is 18 orange trees per acre. Exactly 792 orange trees grow in orangeland. How many acres are in orangeland?....

question

SAT, 29.12.2021 04:10

Kent multiplies both sides of the equation below by an expression. K + startfraction 12 over k endfraction = 8 then he moves all the terms to one side...

question

SAT, 29.12.2021 04:10

Compare the character of faustus at the beginning of the play with his character at the end. How have his character traits and basic ambitions shifted...

question

Biology, 29.12.2021 04:10

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA...

question

SAT, 29.12.2021 04:10

A stone fell from the top of a cliff into the ocean. In the air, it had an average speed of 161616 \text{m/s}m/sstart text, m, slash, s, end text. In...

question

Mathematics, 29.12.2021 04:10

What is 18 1/5 -7 3/5 as a mixed number in simplest form...

More questions: Mathematics Another questions

Questions on the website: 13722363