subject

Mathematics, 30.10.2020 14:00 lovecats12

Can you help me answering this?

Can you help me answering this?

ansver

Answers: 1

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 19:00

The distributive property allows you to say that 3(x − 1) = 3x −

Answers: 1

question

Mathematics, 21.06.2019 21:00

5x−4≥12 or 12x+5≤−4 can you with this problem

Answers: 3

question

Mathematics, 21.06.2019 23:00

In trapezoid abcd, ac is a diagonal and ∠abc≅∠acd. find ac if the lengths of the bases bc and ad are 12m and 27m respectively.

Answers: 3

question

Mathematics, 21.06.2019 23:00

Find the dimensions of the circle. area = 64π in.² r= in.

Answers: 1

You know the right answer?

Can you help me answering this?
...

Questions

question

Biology, 16.04.2020 23:14

If 10 percent of energy moves up to the next level of the ecosystem, what percentage of energy is lost as heat?...

question

Social Studies, 16.04.2020 23:14

At the conclusion of the Reconquista, there were no more Islamic states in A. Eastern Europe. B. Western Europe. C. East Asia. D. North Africa....

question

Mathematics, 16.04.2020 23:14

3) 4 friends equally share 13 of a pan of brownies. How much of the whole pan of brownies does each friend get?...

question

Mathematics, 16.04.2020 23:14

The angle of elevation of the top of a flagpole from a point on the ground 30 meters from the base of the flagpole is 18 degrees. What is the he...

question

English, 16.04.2020 23:14

What are examples of two species dividing up the parts of a habitat...

question

Business, 16.04.2020 23:14

Pasadena Candle Inc. projected sales of 800,000 candles for the year. The estimated January 1 inventory is 35,000 units, and the desired December 31 i...

question

Arts, 16.04.2020 23:14

Which of the following was popular compositional technique during the renaissance...

question

Biology, 16.04.2020 23:14

What is Nonconsciousness...

question

Mathematics, 16.04.2020 23:14

Which could be the length of KL?...

question

Biology, 16.04.2020 23:14

The Punnett square obtained by the dihybrid cross between two pea plants is shown in the table. Both plants have genotype RrYy. Based on the above dat...

question

English, 16.04.2020 23:14

Miss Meriwether of the missionary circle complains about her cooks and fieldhands what does that tell us about her...

question

Business, 16.04.2020 23:14

Eastern Corporation has $1,000 par value bonds with 4 years to maturity. The bonds pay an 8% coupon rate with semi-annual coupon interest payments. Th...

question

Mathematics, 16.04.2020 23:14

Gravel is being dumped from a conveyor belt at a rate of 20 cubic feet per minute. It forms a pile in the shape of a right circular cone whose base di...

question

Spanish, 16.04.2020 23:14

10 citas textuales donde puedan ubicar figuras heroicas...

question

Mathematics, 16.04.2020 23:14

F(x) = (x – 4)(x + 2)? which point is an x intercept of the quadratic function...

question

Mathematics, 16.04.2020 23:14

The measure of a central angle is 80 degrees. The length of the radius is 40 mm. Determine the arc length....

question

Biology, 16.04.2020 23:14

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

question

Chemistry, 16.04.2020 23:14

Consider N O2 molecules in a container of volume V at a pressure of P=1 atm and a temperature of T=298K. a. Calculate the collision frequency Z1 of a...

question

Mathematics, 16.04.2020 23:14

A researcher records the repair cost for 2020 randomly selected stereos. A sample mean of $57.17$ 57.17 and standard deviation of $19.26$ 19.26 are su...

question

Mathematics, 16.04.2020 23:14

Look at the pentagonal numbers. Use finite differences to determine which function represents the pattern. f(x) = 1.5x + 0.5x f(x) =...

More questions: Mathematics Another questions

Questions on the website: 13722363