Mathematics, 17.11.2020 07:50 GILLIG6003

Helppp im so confused A biologist is studying the growth of a particular species of algae. She writes the following equation to show the radius of the algae, f(d), in mm, after d days:

f(d) = 7(1.06)d

What is the average rate of change of the function f(d) from d = 4 to d = 11, and what does it represent?

Answers: 2

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 12:30

The expression 20l+25g-10 calculates the number of dollars that the abc lawn company. how many dollars does the company make from raking 444 gardens and mowing 333 lawns

Answers: 3

Answer

Mathematics, 21.06.2019 16:40

What is the ratio of the change in y-values to the change in x-values for this function? a) 1: 13 b) 2: 5 c) 5: 2 d) 13: 1

Answers: 3

Answer

Mathematics, 21.06.2019 18:20

What is the solution to the equation? k/6.4=8.7 2.3 5.568 15.1 55.68

Answers: 1

Answer

Mathematics, 21.06.2019 18:30

Which one is true about the hexagons ?

Answers: 3

Answer

You know the right answer?

Helppp im so confused A biologist is studying the growth of a particular species of algae. She writ...

Questions

Social Studies, 16.12.2021 19:20

What are some amendment ideas?...

Mathematics, 16.12.2021 19:20

Mr. Paige used similar pentagons to make a design. Which statements about the pentagons in the design must be true? Select the two that apply....

Mathematics, 16.12.2021 19:20

A tank's length is 4 feet longer than its width. The height is 1 foot less than the width. The volume of the tank is 96 cubic feet. What is the width...

Mathematics, 16.12.2021 19:20

Write the six trigonometric functions for a right triangle with legs of length 21 and 28, is adjacent to the leg of length 28....

Computers and Technology, 16.12.2021 19:20

X = int (input ("Enter a number: ")) if ( xB): print ("A") if (x >= 10): print ("8") if (x < 10) print ("C...

English, 16.12.2021 19:20

the picture, there is a pair of socks the floor. * At - on O - In - on O On - at O In - under...

History, 16.12.2021 19:20

What did James II do when the people that Parliament invited to England arrived?...

English, 16.12.2021 19:20

There is a green toy box the desk. O under O in O on O at...

History, 16.12.2021 19:20

The Supreme Court ruled in the Northern Securities Trust case that the monopoly was illegal and the trust should be broken up. monopoly was legal and...

English, 16.12.2021 19:20

According to the text, which of the following is a possible consequence for a teen who is repeatedly out past curfew?...

Mathematics, 16.12.2021 19:20

Tyler bought 14 tickets to a basketball game. The group rate saved him $5.25 per ticket. He paid a total of $283.50 for the tickets. What was the re...

Physics, 16.12.2021 19:20

The speed of light in cubic zirconia is 1.39*10^8 m/s. What is the index of refraction for cubic zirconia?

English, 16.12.2021 19:20

Competition Builds Better Dancers Dance Competitions: The Dark Side of Dance How does the author’s point of view in “Competition Builds...

English, 16.12.2021 19:20

Wood is to carpenter as diamond is towomanjewelryconsumer jeweler...

Mathematics, 16.12.2021 19:20

A parallelogram has side lengths of 10cm and 8cm and an angle has measure 60 degrees...

Arts, 16.12.2021 19:20

Directions: Write the corresponding number in the blank next to the correct answer. Making up a dance Using all the space Repeat t...

English, 16.12.2021 19:20

Use the text to answer the question. While Cable network ratings are down, there are now over 300 streaming services available. This is because it is...

Biology, 16.12.2021 19:20

DNA message #2: GAGCGCACCATCGGGAAGCTA Transcription: Translation:...

Mathematics, 16.12.2021 19:20

dan eric and frank are the leading scorers on their basketball team. over the course of their high school careers, dan scored 6/10 of the points that...

Biology, 16.12.2021 19:20

Do you think the breakup of Pangaea contributed to the extinction of some dinosaurs?...

More questions: Mathematics Another questions