Mathematics, 08.03.2021 18:40 montgomerykarloxc24x

Please explain on how u got the answer

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 20:30

In priyas math class there are 10 boys and 15 girls. what is the ratio of boys to girls in priyas math class? express your answer as a decimal

Answers: 1

Answer

Mathematics, 21.06.2019 23:30

Tatiana wants to give friendship bracelets to her 32 classmates. she already has 5 bracelets, and she can buy more bracelets in packages of 4. write an inequality to determine the number of packages, p, tatiana could buy to have enough bracelets.

Answers: 1

Answer

Mathematics, 22.06.2019 01:10

I'm marking the brainliest and it's 15 points

Answers: 1

Answer

Mathematics, 22.06.2019 01:30

5cakes cost 3.50 how much do 7 cakes cost

Answers: 2

Answer

You know the right answer?

Please explain on how u got the answer
...

Questions

History, 04.07.2019 12:30

James monroe, patrick henry, and george mason were leaders of which group?...

Social Studies, 04.07.2019 12:30

Which of the following is a true statement about the state & federal amendment processes? a) the process at the state level has more opportunity...

Chemistry, 04.07.2019 12:30

Is a flame test of an element a chemical or physical change?...

Mathematics, 04.07.2019 12:30

Vicki paid $22.95 for a sweater that usually sells for $27. what percent discount did she receive?...

Biology, 04.07.2019 12:30

In which of these illnesses do cells in one part of the body grow abnormally or out of control and possibly spread to other parts of the body?...

Spanish, 04.07.2019 12:30

Where is abraham ahora? with mrs. morningstar hiding with william en el cementerio en el zoológico...

History, 04.07.2019 12:30

Did the civil war end before or after the assassination of abraham lincoln...

Biology, 04.07.2019 12:30

5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for theme template strand above. what would the mrna be based upon the template strand a...

Biology, 04.07.2019 12:30

Explain the main difference between organisms of the domains bacteria and archaea and organisms of the domain eukarya....

Spanish, 04.07.2019 12:30

El verbo ser y estar i. complete the story, use the correct form of the verb "ser" or "estar" el juan. el de arizona. juan muy triste. juan perdio...

Business, 04.07.2019 12:30

Afirm has $100 million in revenues. does that mean it has generated a cash flow of $100 milion?...

Mathematics, 04.07.2019 12:30

What are the roots of the equation? 6x^2=18x...

Chemistry, 04.07.2019 12:30

Achange that occurs when a substance changes composition by forming one or more new substances...

Physics, 04.07.2019 12:30

An object has a constant acceleration of 3.2 m/s^2.at a certain instant its velocity is 10 m/s . what is its velocity after 5 sec...

Social Studies, 04.07.2019 12:30

An election held within a political party at which the voters choose candidates who will appear on the ballot in an upcoming general election is a(n)...

English, 04.07.2019 12:30

Hunger games movie what work have they generated/produced in the past?...

Social Studies, 04.07.2019 12:30

Chandra believes that her astrological sign, libra, provides a guide for her daily and weekly actions. she reads her horoscope every morning without f...

Mathematics, 04.07.2019 12:30

What is the slope of y-intercept of this line? y=-6x+2...

Business, 04.07.2019 12:30

If the amount payable in two years is $2420 for a simple loan at 10 percent interest, the loan amount is...

English, 04.07.2019 12:30

Did you know african elephant is an endangered species? a. an b. _ c. the...

More questions: Mathematics Another questions