Mathematics, 19.10.2019 10:00 lydiakegg454

Plz me first one who answers it right gets 40 points

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 20.06.2019 18:04

The circumference of a circle is 60 pi cm3what is the radius of the circle

Answers: 2

Answer

Mathematics, 21.06.2019 14:50

Need to increase the numbers of customers i talk to daily by 20% how many customers do i need to talk to if i talk to a average of 8 customers per hour during an 8 hour shift

Answers: 2

Answer

Mathematics, 21.06.2019 19:40

In angle pqr find the measure of

Answers: 1

Answer

Mathematics, 21.06.2019 23:00

Susie wants to take her friend out for lunch.she wants to spend $9.75 each person. how much will she spend in all.

Answers: 2

Answer

You know the right answer?

Plz me first one who answers it right gets 40 points
...

Questions

Engineering, 04.04.2020 13:58

11.4 Compute the volume percent of graphite VGr in a 3.5 wt% C cast iron, assuming that all the carbon exists as the graphite phase. Assume densities...

Biology, 04.04.2020 13:58

How can longshore currents be dangerous to swimmers?...

Mathematics, 04.04.2020 13:58

Point T is on line segment SU. Given ST = 3x+2, TU= 3x+4, and SU= 5x+9, determine the numerical length of SU...

Mathematics, 04.04.2020 13:58

Rachel is a stunt driver, and she's escaping from a building that is about to explode! DDD represents Rachel's remaining distance (in meters) af...

Business, 04.04.2020 13:59

In an appraisal interview, the rating manager should never . take any responsibility for an employee's performance assist the employee in setting goal...

Biology, 04.04.2020 13:59

Twenty-five people developed symptoms of nausea, vomiting, and diarrhea three to six hours after attending a church picnic where they ate a ham and gr...

History, 04.04.2020 13:59

How many representatives are there in the U. S. House of Representatives ( Lower House)?...

Business, 04.04.2020 13:59

A writer’s company has just adopted a policy of employee e-mail surveillance to determine which employee is leaking confidential information. Because...

Chemistry, 04.04.2020 13:59

The reaction below has a Kp value of 3.3 × 10-5. What is the value of Kc for this reaction at 700 K? Note: Type the correct answer with 1 decimal plac...

Mathematics, 04.04.2020 13:59

An isocost line Question 7 options: 1) represents the combinations of w and K that cost the firm the same amount of money. 2) represents the combinati...

Mathematics, 04.04.2020 13:59

Thirty-six of the staff of 80 teachers at a local intermediate school are certified in Cardio-Pulmonary Resuscitation (CPR). In 180 days of school, ab...

Mathematics, 04.04.2020 13:59

PLEASE HELP I WILL MARK BRAINLIEST...

Mathematics, 04.04.2020 13:59

PLEASE!! Dinah invests $850 in a high-yield savings account. The account pays 3% simple interest annually. Is it reasonable that Dinah wil...

Biology, 04.04.2020 13:59

Which steps are part of the process during the formation of molded fossils? Check all that apply. Sediment hardens into rock. Sedime...

Mathematics, 04.04.2020 13:59

PLEASE HELP WILL NAME BRAINLIEST...

Computers and Technology, 04.04.2020 14:00

Which of the following is true of data collection:. a. Data collection is of secondary importance to computer security. b. Data collection should not...

Physics, 04.04.2020 14:00

An air-plane has an effective wing surface area of 17.0 m² that is generating the lift force. In level flight the air speed over the top of the wings...

Biology, 04.04.2020 14:00

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along thi...

Chemistry, 04.04.2020 14:00

2.00 moles of an ideal gas was found to occupy a volume of 17.4L at a pressure of 3.00 atm and at a temperature of 45 C. Calulate the value of the cas...

Mathematics, 04.04.2020 14:00

A group of n people enter an elevator in a building with k floors. Each person independently selects a floor uniformly at random (each with equal prob...

More questions: Mathematics Another questions