subject
Mathematics, 07.05.2021 14:00 AreYouMyNewDad

Amplitude-1 period- pi Max value- 2 Min value-0 midline-1

Just need a picture graph please

ansver
Answers: 3
Show answers

Another question on Mathematics

question
Mathematics, 20.06.2019 18:02
Awork system has five stations that have process times of 5, 9, 4, 9, and 8. what is the throughput time of the system?
Answers: 3
Answer
question
Mathematics, 21.06.2019 19:30
Find the area of the unshaded square
Answers: 1
Answer
question
Mathematics, 21.06.2019 20:30
If you are dealt 4 cards from a shuffled deck of 52? cards, find the probability that all 4 cards are diamondsdiamonds.
Answers: 1
Answer
question
Mathematics, 21.06.2019 22:30
For the chance to be team captain, the numbers 1-30 are put in a hat and you get two chances to pick a number, without replacement. which formula correctly shows how to find the probability that you choose the number 1 and then 2?
Answers: 1
Answer
You know the right answer?
Amplitude-1 period- pi Max value- 2 Min value-0 midline-1

Just need a picture graph pl...
Questions
question
Biology, 01.04.2021 17:30
Explain how the administration of the anti tetanus serum prevents tetanus....
question
Business, 01.04.2021 17:30
Disney and Paramount are both releasing an animated movie at the same time. Each company is fairly well known, and they are both deciding between purs...
question
Biology, 01.04.2021 17:30
What happens when the south end of Earth’s axis is tilted toward the Sun? which describes a way that prevailing winds control precipitation totals in...
question
History, 01.04.2021 17:30
Please help me with four minute speech about health :(( i'll give you brainliest...
question
Mathematics, 01.04.2021 17:30
Susie is paying $568.97 every month for her $150,000 mortgage. If this is a 30 year mortgage, how much interest will she pay over the 30 years of paym...
question
Mathematics, 01.04.2021 17:30
Jawan made a table to figure out how much he earns at his job (image below)
question
Mathematics, 01.04.2021 17:30
Geometry Questions s ...
question
Business, 01.04.2021 17:30
On December 31, 2015, Nolte Co. is in financial difficulty and cannot pay a note due that day. It is a $3,000,000 note with $300,000 accrued interest...
question
Biology, 01.04.2021 17:30
Many mammals whose diet includes a great deal of leafy plant matter have extra compartments or extensions of their digestive tract that are not presen...
question
Mathematics, 01.04.2021 17:30
ANSWER QUICK PLS Find m4 if m1 = 100°. a. 100° b. 80° c. 180° d. 90°
question
English, 01.04.2021 17:30
can some one help me with this not all the answers fit in this one so i'll post as many as i can and post the restin another one.
question
History, 01.04.2021 17:30
At the "first Thanksgiving," the Pilgrims famously feasted with the American Indians. Think about what you learned about Pilgrims, Puritans, and Ameri...
question
English, 01.04.2021 17:30
Which sentence best explains Lincoln's wartime decisions? BRANLIEST adapted from Lincoln the Great by Wilfred W. McClay We should r...
question
English, 01.04.2021 17:30
What Is the parallel structure and how do I find it?...
question
Business, 01.04.2021 17:30
The manufacturing overhead budget at Foshay Corporation is based on budgeted direct labor-hours. The direct labor budget indicates that 7,800 direct l...
question
English, 01.04.2021 17:30
For a company to develop an effective customer-centric culture, there is always room for:...
question
Mathematics, 01.04.2021 17:30
This math problem help me...
question
Biology, 01.04.2021 17:30
What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?...
question
Chemistry, 01.04.2021 17:30
Which of the following statements are true regarding the remainder of the experiment if the scientist wants to use the combined gas law to calculate d...
question
Biology, 01.04.2021 17:30
Which scenario MOST LIKELY represents genetic drift and why? Question 2 options: Scenario 2, because the dark beetles are most fit for th...
More questions: Mathematics Another questions
Questions on the website: 13722360
See results (0)