subject

Mathematics, 10.02.2022 14:00 zylovesnesha

Number 13 please. it’s the answe. r

Number 13 please.it’s the answe.r

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 22:20

Which is the focus of a parabola with equation y2=4x

Answers: 1

question

Mathematics, 21.06.2019 23:00

If mary had 320 toy cars and she gave her friend 50 cars and then she gave her brother 72 more cars how much toy cars would mary have left ● explain with proper details

Answers: 1

question

Mathematics, 22.06.2019 00:30

Me i’m stuck on all these questions besides the two bottom ones

Answers: 2

question

Mathematics, 22.06.2019 02:30

Two farmers pay a total rent of $140 for a pasture. the first farmer placed $4 oxen in the pasture, and the second farmer placed $30 sheep in the pasture. the farmers split the rent based on the proportion of the pasture eaten by their own animals that month. how much should the first farmer pay, if 1 ox eats as much as 10 sheep in a month?

Answers: 1

You know the right answer?

Number 13 please. it’s the answe. r
...

Questions

question

Business, 28.10.2019 21:31

Sold goods costing $1,200 for $2,000 on account. after two weeks the customer returned the goods. there is nothing wrong with the goods; the customer...

question

Business, 28.10.2019 21:31

Two balloons contain the same amounts of water, sugar, and yeast. two other balloons contain the same amount of water, but have no sugar or yeast. the...

question

Spanish, 28.10.2019 21:31

2. javier piensa en abrir una compañía exportadora de café. cierto falso 3. el padre de javier tiene conexiones con contadores en barcelona. ci...

question

Spanish, 28.10.2019 21:31

1- escogermultiple choice activity audio instructionslisten to each question and choose the most logical response. october 18 11: 59 pm 1 attempt rema...

question

Computers and Technology, 28.10.2019 21:31

Python question: write a program that generates a random number in the range of 1 through 100, and asks the user to guess what the number is. if the...

question

Health, 28.10.2019 21:31

Indicate whether each statement is true or false regarding type 1 and type 2 diabetes mellitus. 1. type 1 diabetes mellitus is also called non-...

question

Business, 28.10.2019 21:31

Molly mocha employs one college student every summer in her coffee shop. the student works the five weekdays and is paid on the following monday. (for...

question

Chemistry, 28.10.2019 21:31

Which has the higher enthalpy under these conditions, 2 o3(g) or 3 o2(g)?...

question

Business, 28.10.2019 21:31

Jill lives in a large metropolitan area. she is thinking about starting a senior citizen van service, where she will pick up seniors from nursing home...

question

Mathematics, 28.10.2019 21:31

Give an example of a quadratic equation with 2 + 3i as one of its solutions...

question

Mathematics, 28.10.2019 21:31

Define: voluntary responsea) every possible sample of a given size has the same chance to be selected. b) using extraneous factors to create similar...

question

Chemistry, 28.10.2019 21:31

Which of these equations represent reactions that could be used in constructing an electrochemical cell? check all that apply....

question

Chemistry, 28.10.2019 21:31

By looking at the uncertainty of the bacterium's position, did the student have a valid point? a. the student has a point. the uncertainty of...

question

Biology, 28.10.2019 21:31

Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this mrna? provide the sequence in form (sing...

question

Biology, 28.10.2019 21:31

What is the main advantage of a sole proprietorship?...

question

Physics, 28.10.2019 21:31

Development of life goals, access to community resources, long-term counseling, and accountability are all examples of case management....

question

Mathematics, 28.10.2019 21:31

Ababy woolly mammoth that was discovered in 2007 died approximately 39,000 years ago. how many c-14 atoms per 1.0 × 108 c-12 atoms would have be...

question

Mathematics, 28.10.2019 21:31

Use the method in the example to find the square roots of 1 + √3i...

question

Business, 28.10.2019 21:31

The term ""insecure laboratory procedures"" in the definition of a biohazard presented in this educational module refers to which element of biohazard...

question

Business, 28.10.2019 21:31

The town of genter recently witnessed a devastating hurricane that crippled the town's infrastructure. q-mart, a retail chain that plans to open a new...

More questions: Mathematics Another questions

Questions on the website: 13722359