subject

Medicine, 27.08.2020 04:01 luislopez05

Fludrocortisone is prescribed for a client with Addison's disease. The primary health care provider needs to be notified if the client experiences which conditions

ansver

Answers: 1

Show answers

Another question on Medicine

question

Medicine, 09.07.2019 19:20

Anurse is caring for a client who has acute heart failure and is receiving furosemide via iv bolus. the nurse should identify that which of the following findings indicates a desired therapeutic effect? a. increased sputum production b. decreased weight c. decreased blood glucose level d. increased blood pressure

Answers: 3

question

Medicine, 09.07.2019 20:20

Where does systemic venous blood enter the heart? a. right ventricle b. left atrium c. right atrium d. left ventricle

Answers: 2

question

Medicine, 09.07.2019 20:20

Which of the following is an example of airborne transmission? a. sneezing by an infected person not covering his mouth b. acquiring a disease from an insect bite c. fomites, such as hospital bedding and linen d. inanimate objects, such as medical equipment and supplies

Answers: 2

question

Medicine, 09.07.2019 21:10

Stratified systems are: caste, slavery, class and estate. in your opinion which 2 stratified systems have the most in common. then discuss 2 systems you believe to be the least similar.

Answers: 3

You know the right answer?

Fludrocortisone is prescribed for a client with Addison's disease. The primary health care provider...

Questions

question

History, 04.04.2020 13:59

How many representatives are there in the U. S. House of Representatives ( Lower House)?...

question

Business, 04.04.2020 13:59

A writer’s company has just adopted a policy of employee e-mail surveillance to determine which employee is leaking confidential information. Because...

question

Chemistry, 04.04.2020 13:59

The reaction below has a Kp value of 3.3 × 10-5. What is the value of Kc for this reaction at 700 K? Note: Type the correct answer with 1 decimal plac...

question

Mathematics, 04.04.2020 13:59

An isocost line Question 7 options: 1) represents the combinations of w and K that cost the firm the same amount of money. 2) represents the combinati...

question

Mathematics, 04.04.2020 13:59

Thirty-six of the staff of 80 teachers at a local intermediate school are certified in Cardio-Pulmonary Resuscitation (CPR). In 180 days of school, ab...

question

Mathematics, 04.04.2020 13:59

PLEASE HELP I WILL MARK BRAINLIEST...

question

Mathematics, 04.04.2020 13:59

PLEASE!! Dinah invests $850 in a high-yield savings account. The account pays 3% simple interest annually. Is it reasonable that Dinah wil...

question

Biology, 04.04.2020 13:59

Which steps are part of the process during the formation of molded fossils? Check all that apply. Sediment hardens into rock. Sedime...

question

Mathematics, 04.04.2020 13:59

PLEASE HELP WILL NAME BRAINLIEST...

question

Computers and Technology, 04.04.2020 14:00

Which of the following is true of data collection:. a. Data collection is of secondary importance to computer security. b. Data collection should not...

question

Physics, 04.04.2020 14:00

An air-plane has an effective wing surface area of 17.0 m² that is generating the lift force. In level flight the air speed over the top of the wings...

question

Biology, 04.04.2020 14:00

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along thi...

question

Chemistry, 04.04.2020 14:00

2.00 moles of an ideal gas was found to occupy a volume of 17.4L at a pressure of 3.00 atm and at a temperature of 45 C. Calulate the value of the cas...

question

Mathematics, 04.04.2020 14:00

A group of n people enter an elevator in a building with k floors. Each person independently selects a floor uniformly at random (each with equal prob...

question

Chemistry, 04.04.2020 14:01

What is likely to be true about the ∆H for this reaction? C6H6 (l) → C6H6 (s) ∆H>0 ∆H=0 ∆H<0...

question

Mathematics, 04.04.2020 14:01

Cole is studying employment trends.He found that 20% of the social workers he surveyed, or 45 social workers,work part time. How many soci...

question

Business, 04.04.2020 14:01

A 12-year bond of a firm in severe financial distress has a coupon rate of 12% and sells for $920. The firm is currently renegotiating the debt, and i...

question

Business, 04.04.2020 14:01

Magic Milling Company has 9% annual coupon bonds that are callable and have 18 years left until maturity. The bonds have a par value of $1,000, and th...

question

Mathematics, 04.04.2020 14:01

He assignment problem is . ANSWER Unselected a specialized form of an optimization model that attempts to assign limited capacity to various demand po...

question

Mathematics, 04.04.2020 14:01

Ashley picked up 15 rocks. 3 igneous, 3 metamorphic, and 9 sedimentary. What is the ratio of sedimentary rocks to the total number of rocks?...

More questions: Medicine Another questions

Questions on the website: 13722363