This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place. ATTTGCATACTACCGGGC The red letters are the noncoding region, and the black letters are the protein coding region. ATTAGCATACTACGGGC ATTTGCATACTGACCGGGC ATTTGCAATACTACCGGGC ATTTGCAACTACCGGGC ATGAATGCATACTACCGGGC

Kate is 14 years old and just started taking dance classes with her friends at a local dance studio. this is her first time in a dance program, so everything is new to her. her friends convinced her to join the class since they have been enjoying it for a few months. how could the following terms her succeed in the dance class? ● secondary reinforcement ● identity vs. role confusion ● observational learning how could the following terms hinder her success in the class? ● circadian rhythm ● basal ganglia ● vestibular sense